The mut-16(mg461) mutation which causes an Rde phenotype on, e.g., nhr-23 or lin-29 feeding RNAi, was found in the background of two strains from distinct labs (see Gabel et al., A, this issue of WBG). We are testing for this mutation in strains from several labs, starting with CGC strains currently used in our lab. 11 out of 80 strains surveyed (14 total so far), have deletions with the same PCR size difference as mg461.

Many of these strains are “TR” strains containing mutations in smg genes (Table 1), but our survey was heavily weighted with smg strains. Many, but not all, of these smg mutations map to LGI near mut-16, and there are “TR” smg strains that lack the deletion. Thus the mutation may have existed in some strains used to isolate smg mutants or in the “N2” strain used for backcrossing them. Indeed, the Anderson and Kimble lab N2 strains contain mg461, whereas the tested N2 strains in the Ruvkun lab do not (see Frater-Rubsam and Anderson, this issue of WBG). A common theme to most mg461 strains is an MRC connection. Since the smg genes encode nonsense-mediated decay (NMD) pathway components, the presence of mg461 in the many smg strains may confound RNAi-based studies of this pathway as well as studies of the intersection of the RNAi and NMD pathways.

Our survey of C. elegans strains is not yet comprehensive. Systematic genotyping of strains for the mg461 lesion will indicate its prevalence, and may help to delineate its origin, likely the MRC about 25 years ago.

Do mutations affecting RNAi pathways offer a selective advantage in the lab? Perhaps mg461 increases male production and is selected when males are generated for crosses, though we have not detected Him phenotypes in mg461 strains. Or mg461 may produce a wider array of transitions and transversions after an EMS mutagenesis, yielding more sequence space exploration to the savant geneticists of the Middle Ages of the MRC. Arguing against a mutator phenotype, we have not detected evidence of activation of transposons in the mut-16(mg461) strain. Finally, resistance to viral or bacterial plagues, or to the nutritional and desiccation challenges afforded by our animal husbandry practices, are also possible.

Genotyping Assay: The mut-16(mg461) deletion is detectable by PCR genotyping using the following primers: primer 1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG. Strains that are wild-type at the locus will yield a 824bp PCR product, while a 373bp product is observed from strains that contain mg461.