While investigating possible relationships between nonsense-mediated mRNA decay and RNAi, we noticed that some smg mutants have altered responses to RNAi. Feeding RNAi targeting either unc-54 or dpy-13 (but not unc-22) is more efficient in some, but not all, smg mutants. “More efficient” describes RNAi responses that are intermediate between the strongly enhanced RNAi of eri-1(mg366) (enhanced RNA interference) and a “normal” RNAi response of our N2 strain. Twelve of 23 smg mutants, including all five tested alleles of smg-1, exhibited more efficient RNAi when compared to N2. RNAi efficiency of the remaining 11 smg mutants, including alleles of smg-2, smg-3, smg-4, smg-5, and smg-6, was indistinguishable from N2.

We subsequently discovered that our stock of N2 (hereafter termed N2-Anderson) is less sensitive to feeding RNAi than that of three other N2 stocks, one obtained from the CGC and two obtained from the Scott Kennedy and John White labs. The “more efficient” RNAi of N2-CGC strains is similar to that described above for certain smg mutants. RNAi efficiency of an N2 obtained from Judith Kimble’s lab is indistinguishable from N2-Anderson. These results suggested that N2-Anderson and possibly N2-Kimble contain a modifier of RNAi efficiency. We therefore crossed eri-1(mg366) repeatedly into an N2-Anderson genetic background. RNAi of the resulting strain [eri-1(mg366)-Anderson] is less efficient than that of the starting eri-1(mg366) mutant. Thus, N2-Anderson has a weak Rde (RNAi defective) phenotype that modifies the Eri phenotype of eri-1(mg366).

We recently learned from Harrison Gabel and Gary Ruvkun (Gabel et al., A) of mut-16(mg461) and its subtle Rde phenotype. They kindly communicated the sequences of primers that distinguish mut-16(mg461) from mut-16(+), and we genotyped the several different N2 stocks in our lab. Both N2-Anderson and N2-Kimble contain mut-16(mg461), but N2-CGC does not. Thus, the apparent increased RNAi efficiency of smg mutants described above may be due to decreased RNAi efficiency of N2-Anderson and related strains (see Gabel et al., A and Gabel et al., B for more detailed information).

The presence of mut-16(mg461) in N2-Anderson provides an obvious avenue for its inheritance in current smg strains. We isolated “r” alleles of smg genes in the late 1980s in both N2 and non-N2 genetic backgrounds (for example, transposon-active strains) whose mut-16 genotype has not yet been tested. All smg alleles, however, were outcrossed with N2-Anderson while being cleaned up, and this may have introduced mut-16(mg461) into some backgrounds but not others.

The Anderson and Kimble lab stocks of N2 were brought from the MRC-Cambridge to Madison in the early 1980s. Gabel et al., A (this issue of WGB) demonstrate that CB3388 [ncl-1(e1865)], which was isolated in Cambridge by Ed Hedgecock around 1980, contains mut-16(mg461). If the numerous instances of mut-16(mg461) found in today’s strains are related by descent, then mut-16(mg461) likely existed in at least some Cambridge strains in the early 1980s.

We are presently uncertain whether all differences we observe concerning the efficiency of RNAi in smg mutants are due to mut-16(mg461), but it seems possible, and we’re currently genotyping mut-16(mg461) in a number of key strains.

The mut-16(mg461) mutation which causes an Rde phenotype on, e.g., nhr-23 or lin-29 feeding RNAi, was found in the background of two strains from distinct labs (see Gabel et al., A, this issue of WBG). We are testing for this mutation in strains from several labs, starting with CGC strains currently used in our lab. 11 out of 80 strains surveyed (14 total so far), have deletions with the same PCR size difference as mg461.

Many of these strains are “TR” strains containing mutations in smg genes (Table 1), but our survey was heavily weighted with smg strains. Many, but not all, of these smg mutations map to LGI near mut-16, and there are “TR” smg strains that lack the deletion. Thus the mutation may have existed in some strains used to isolate smg mutants or in the “N2” strain used for backcrossing them. Indeed, the Anderson and Kimble lab N2 strains contain mg461, whereas the tested N2 strains in the Ruvkun lab do not (see Frater-Rubsam and Anderson, this issue of WBG). A common theme to most mg461 strains is an MRC connection. Since the smg genes encode nonsense-mediated decay (NMD) pathway components, the presence of mg461 in the many smg strains may confound RNAi-based studies of this pathway as well as studies of the intersection of the RNAi and NMD pathways.

Our survey of C. elegans strains is not yet comprehensive. Systematic genotyping of strains for the mg461 lesion will indicate its prevalence, and may help to delineate its origin, likely the MRC about 25 years ago.

Do mutations affecting RNAi pathways offer a selective advantage in the lab? Perhaps mg461 increases male production and is selected when males are generated for crosses, though we have not detected Him phenotypes in mg461 strains. Or mg461 may produce a wider array of transitions and transversions after an EMS mutagenesis, yielding more sequence space exploration to the savant geneticists of the Middle Ages of the MRC. Arguing against a mutator phenotype, we have not detected evidence of activation of transposons in the mut-16(mg461) strain. Finally, resistance to viral or bacterial plagues, or to the nutritional and desiccation challenges afforded by our animal husbandry practices, are also possible.

Genotyping Assay: The mut-16(mg461) deletion is detectable by PCR genotyping using the following primers: primer 1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG. Strains that are wild-type at the locus will yield a 824bp PCR product, while a 373bp product is observed from strains that contain mg461.

Antisense reagents can serve as efficient and versatile tools for studying gene function by blocking nucleic acids in vivo. Presently no antisense reagents are available for inhibiting miRNAs in the nematode C. elegans. Such a technique would provide a convenient approach to study functions of miRNAs whose deletion strains are difficult to generate, to dissect functions of individual miRNAs that are clustered together, or to block intronic miRNAs without perturbing the function of the corresponding protein-coding genes.

Previous studies by Hutvagner et al. showed that an antisense 2′-O-methyl oligoribonucleotide injected into worm larvae could inhibit let-7 (Hutvagner et al., 2004) However, injection of worm larvae is technically very demanding, and this method cannot be applied to study miRNAs that are expressed early in development. We have developed a new class of fluorescently labeled antisense reagents to inhibit miRNAs by conjugating 2′-O-methyl oligoribonucleotide with dextran and rhodamine. The dextran-conjugated antisense reagents can be conveniently introduced into the germline of adult hermaphrodites and are transmitted to their progeny, where they efficiently inhibit a targeted miRNA in different tissues, including the hypodermis, the vulva and the nervous system (Table 1). A number of control experiments confirmed that these antisense reagents selectively target their corresponding miRNAs with high sequence specificity. Further, these reagents can be used combinatorially to inhibit more than one miRNAs in the same animal, thus providing a convenient approach to examine genetic interactions that involve miRNA, especially when combined with numerous mutants or reporter stains available.

Table 1. Inhibit miRNAs in C. elegans using dextran-conjugated antisense reagents.

^a “^RhD” denotes rhodamine labeled dextran; “^as-2’OMe” represents antisense 2’-O-methyl oligoribonucleotide.