Caenorhabditis elegans is becoming an important model in pharmacology and toxicology (Leung et al., 2008), but there is little biochemical information regarding its xenobiotic metabolic capacity. The current study investigated the in vivo activity of C. elegans with two human cytochrome P450 (CYP) substrates, phenacetin and testosterone, which are metabolized by human CYP1A2 and CYP3A enzymes, respectively, into acetamidophenol and 6β-hydroxytestosterone via deethylation and hydroxylation reactions.

Each experiment included (a) 50 ml liquid cultures with 30 µM substrate, a mixed-stage N2 (Bristol) population, and OP50 bacteria in S medium; (b) N2 cultures without OP50; (c) OP50 cultures without N2;, and (d) substrate-only controls. All cultures were done in triplicate and incubated on a shaker at 20 °C for 24 hr. OP50 and C. elegans were isolated afterward using centrifugation and sucrose flotation, respectively. The resultant extract was homogenized using sonication and resuspended in 1.5 ml 0.1 N NaCl solution. The culture medium and homogenate were analyzed for substrates and metabolites using HPLC-MS/MS (Micromass Quattro Ultima, Beverly, MA) and published methods (Walsky and Obach, 2004).

C. elegans generated the human CYP3A diagnostic metabolite 6β-hydroxytestosterone in liquid culture with or without OP50 (Table 1). The medium concentration of testosterone in the N2 cultures was nearly eliminated after 24 hr, but was unchanged in both substrate controls and OP50 cultures. This indicated that C. elegans either metabolized or bioconcentrated testosterone. 6β-hydroxytestosterone was detected in the N2 homogenate, demonstrating human CYP3A-like metabolism.

The results of the phenacetin experiment were less clear-cut. The medium concentration of phenacetin in the N2 cultures but not the OP50-only cultures was reduced after 24 hr incubation, but acetamidophenol was never detected at levels exceeding 0.04 µM in any culture medium or homogenate (Table 1). This is likely to result from further metabolism to chemical forms that we did not measure, but testing this hypothesis will require additional experiments.

The current findings suggest that C. elegans possessed human CYP3A-like activities, consistent with previous evidence for a functional role of human CYP3 homologs in C. elegans genome (Leung et al., 2010). However, the finding of modest CYP1A2-like activity was surprising based on previous work (Leung et al., 2010). Clearly further experiments are needed to explore how C. elegans metabolizes pharmaceuticals and toxicants (Kosel et al., 2011; Shäfer et al., 2009).

xpc-1 is the C. elegans homolog of the human xeroderma pigmentosum complementation group C gene, which plays a key role in the identification of DNA damage in the nucleotide excision repair (NER) pathway. Stergiou et al. (2005) found that the RB885 strain of C. elegans, which carries an intronic deletion in the xpc-1 gene, showed an altered apoptotic response to ultraviolet C (UVC) radiation. We tested whether the RB885 strain would exhibit decreased repair of UVC-induced DNA damage, as we observed for another NER mutant, xpa-1 (Meyer et al., 2007). We used dauer larvae in order to eliminate cell division as a potential confounder for our DNA repair assay. DNA repair was not detectably altered in RB885 as compared to either N2 or glp-1 (JK1007) dauers (Fig. 1), using the F33H2.6 target to measure DNA damage. Similarly normal repair was observed in 9 additional nuclear targets. Dauer larvae, nuclear targets used to assess DNA damage/repair, UVC exposures and DNA damage measurements, were as described in Meyer et al. (2007).

We confirmed the presence of the deletion in the RB855 genome using previously-developed primers (Aceserver at UBC), and detected only one unique full-length xpc-1 mRNA in dauer and mixed-stage xpc-1 nematode populations, also using previously-developed primers (WorfDB). Furthermore, we detected no differences in levels of xpc-1 mRNA expression either in unexposed or UV-exposed dauer or mixed-stage xpc-1 and N2 nematodes. xpc-1 mRNA expression was induced modestly (1.5- to 2-fold) in both strains 24 h after UVC exposure (dauers exposed to 50 J/m² UVC; mixed-stage exposed to 200 or 400 J/m² UVC). For mRNA level analysis, we designed primers (forward, 5’- CGGAAGATGAATGGGAAGAA-3’ and reverse, 5’- GTCCATTGCGTATCGTTGTG -3’; product size 962 nt) for use in RT (reverse transcription) PCR. Those primers were designed to include exon-exon junctions to preclude the amplification of any contaminating DNA.