Worm Breeder's Gazette 10(3): 40
These abstracts should not be cited in bibliographies. Material contained herein should be treated as personal communication and should be cited as such only with the consent of the author.
unc-5 is required to guide certain migrating axons and mesodermal cells dorsalward on the nematode epidermis (1987 CSH Meeting Abstracts, p.73). We have sequenced approximately 1500 base pairs of unc-5 open reading frame comprising four putative exons and spanning 4.5 KB of the genome (see map below). The direction of transcription is right to left on the genetic map. The unc-5 message appears to be approximately 3 KB as determined by probing Northern blots with various subcloned fragments from the unc-5 region, so there is clearly more sequencing to be done. As reported in WBG vol.10#2 p. 118, one putative unc-5 exon encodes a pair of tandemly arranged domains (WSX domains) found in a variety of unrelated proteins that exhibit cell and basement membrane binding properties. The homology with these proteins does not extend beyond this domain, nor have we found significant homology with any other proteins in the NBRF database. The sequence determined thus far does have a couple of interesting features. For example, there is a possible transmembrane domain of 26 uncharged amino acids just 3' to the WSX domains. This situation parallels that observed in the circumsporozite protein of the malarial parasites in which the WSX domain is adjacent to a transmembrane domain (1-3); however, it is too soon to say whether unc-5 encodes a transmembrane protein, particularly since we have yet to identify an initiation codon or putative signal sequence. Another intriguing feature of the unc-5 sequence is that intron C ( map) contains a direct repeat of 20 base pairs (TTTCAAAAATTTCATAAAAT on the coding strand). We don't know what, if any, function this sequence might have, but if any of you have any ideas we would be interested to hear them. [See Figure 1]